High Voltage (HV) transmission lines are widely spread around residential places. They take all forms of shapes: concrete, steel, and timber poles. Earth grid always form part of the HV transmission structure, whereat soil resistivity value is one of the main inputs when it comes to determining the earth grid requirements. In this paper, the soil structure and its implication on the electrode r...

The two moth species Heliothis virescens (Hv) and H. subflexa (Hs) are closely related, but have vastly different feeding habits. Hv is a generalist and an important pest in many crops in the USA, while Hs is a specialist feeding only on plants in the genus Physalis. In this study, we conducted a comparative population genetic analysis to assess whether and how generalist and specialist life st...

In the past Smart Power System-on-Chip (SoC) products were almost exclusively designed on Bipolar-CMOS-DMOS (BCD) technologies. These products address applications as diverse as power management for mobile phones, motor drivers, printer head drivers, automotive bus transceivers and dataline drivers for high speed internet or Voice over IP (VoIP). The trend towards SoC design for lowering form f...

INTRODUCTION: Hallux valgus (HV) is a common first metatarsophalangeal (MTP1) joint deformity characterized by lateral deviation of the large toe, medial deviation of the first metatarsal, and hallux pronation [1,2]. Progressive subluxation of the MTP1 joint is common and results in attenuation of the medial soft tissues and contracture of the lateral soft tissues. The flexors and sesamoid comp...

Technical Appendix Table. PCR primer pairs used to recover whole-genome sequences of gemycircularviruses Primer pair Forward primer sequence 5′3′ Reverse primer sequence 5′3′ HV-GcV1–1 TTATATGCCCAGACGGACCC ATTGTGCGGCGGATAGGATA HV-GcV1–2 CGAATTTAACCCCGGATGCA AAGGATGCCACCCGAATGTA HV-GcV1–3 TTGTTCGATCAGACCACCGA GTTCCTTCCGAGCTACAAGT HV-GcV1–4 TCGATGTTAACTCCCTCCGG GAAACGTGTAGATCGGCGAC HV-GcV2–1 TT...

The concept of complex fuzzy sets is a generalization of ordinary fuzzy sets. In this paper, we introduce the concept of complex fuzzy subhypergroups ($H_{v}$-subgroups) as well as the concept of complex anti-fuzzy subhypergroups ($H_{v}$-subgroups). We investigate their properties and their relations with the traditional fuzzy (anti-fuzzy) subhypergroups ($H_{v}$-subgroups), and we prove some ...

Oxidation is an important biochemical defense mechanism, but it also elicits toxicity; therefore, oxidation must be under strict control. In phagocytotic events in neutrophils, the voltage-gated H(+) (Hv) channel is a key regulator of the production of reactive oxygen species against invading bacteria. The cytoplasmic domain of the Hv channel forms a dimeric coiled coil underpinning a dimerized...