نتایج جستجو برای: dgcr8

تعداد نتایج: 347  

Journal: :Proceedings of the National Academy of Sciences of the United States of America 2014
Sara H Weitz Ming Gong Ian Barr Shimon Weiss Feng Guo

DiGeorge syndrome critical region gene 8 (DGCR8) is the RNA-binding partner protein of the nuclease Drosha. DGCR8 and Drosha recognize and cleave primary transcripts of microRNAs (pri-miRNAs) in the maturation of canonical microRNAs (miRNAs) in animals. We previously reported that human, frog, and starfish DGCR8 bind heme when expressed in Escherichia coli and that Fe(III) heme activates apoDGC...

2010
Nayoung Suh Lauren Baehner Felix Moltzahn Collin Melton Archana Shenoy Jing Chen Robert Blelloch

The Dgcr8 delta/flox mice were crossed to Zp3-Cre [1] mice and resulting offsprings were intercrossed to produce Dgcr8 ;Zp3-Cre animals. The following primers were used to genotype mice and the oocytes; P1 5’ primer, TTTCCAACCCAAGTCAGCAGAT ;P1 3’ primer, AGTGCATGTGCCATGCTGCCA; P2 5’ primer, CTGGAGTAGGCATGTTGATTTC; P2 3’ primer, CCTGATTCACTTACAACACAACC; P3 3’ primer, TAAAGCGTCCACATCATTGTC. To de...

2017
Xi-Wen Wang Jing Hao Wen-Ting Guo Le-Qi Liao Si-Yue Huang Xiangpeng Guo Xichen Bao Miguel A. Esteban Yangming Wang

Dgcr8 knockout cells provide a great means to understand the function of microRNAs (miRNAs) in vitro and in vivo. Current strategies to study miRNA function in Dgcr8 knockout cells depend on transient transfection of chemically synthesized miRNA mimics, which is costly and not suitable for long-term study and genetic selection of miRNA function. Here, we developed a cost-effective DGCR8-indepen...

2017
Zhong Liu Cheng Zhang Maria Skamagki Alireza Khodadadi-Jamayran Wei Zhang Dexin Kong Chia-Wei Chang Jingyang Feng Xiaosi Han Tim M. Townes Hu Li Kitai Kim Rui Zhao

Pluripotent stem cells (PSCs) deficient for microRNAs (miRNAs), such as Dgcr8-/- or Dicer-/- embryonic stem cells (ESCs), contain no mature miRNA and cannot differentiate into somatic cells. How miRNA deficiency causes differentiation defects remains poorly understood. Here, we report that miR-302 is sufficient to enable neural differentiation of differentiation-incompetent Dgcr8-/- ESCs. Our d...

Journal: :The Journal of neuroscience : the official journal of the Society for Neuroscience 2013
Yasuo Ouchi Yuya Banno Yuko Shimizu Shouta Ando Hitoki Hasegawa Koichi Adachi Takashi Iwamoto

DiGeorge syndrome chromosomal region 8 (Dgcr8), a candidate gene for 22q11.2 deletion-associated schizophrenia, encodes an essential component for microRNA (miRNA) biosynthesis that plays a pivotal role in hippocampal learning and memory. Adult neurogenesis is known to be important in hippocampus-dependent memory, but the role and molecular mechanisms of adult neurogenesis in schizophrenia rema...

Journal: :Developmental cell 2014
Tian-Lin Cheng Zhizhi Wang Qiuming Liao Ying Zhu Wen-Hao Zhou Wenqing Xu Zilong Qiu

Loss- and gain-of-function mutations of the X-linked gene MECP2 (methyl-CpG binding protein 2) lead to severe neurodevelopmental disorders in humans, such as Rett syndrome (RTT) and autism. MeCP2 is previously known as a transcriptional repressor by binding to methylated DNA and recruiting histone deacetylase complex (HDAC). Here, we report that MeCP2 regulates gene expression posttranscription...

Journal: :EMBO reports 2015
Cassandra D Belair Alireza Paikari Felix Moltzahn Archana Shenoy Christina Yau Marc Dall'Era Jeff Simko Christopher Benz Robert Blelloch

In human prostate cancer, the microRNA biogenesis machinery increases with prostate cancer progression. Here, we show that deletion of the Dgcr8 gene, a critical component of this complex, inhibits tumor progression in a Pten-knockout mouse model of prostate cancer. Early stages of tumor development were unaffected, but progression to advanced prostatic intraepithelial neoplasia was severely in...

2014
Ammad Ahmad Farooqi Muhammad Zahid Qureshi Ender Coskunpinar Syed Kamran-ul-Hassan Naqvi Ilhan Yaylim Muhammad Ismail

MicroRNAs have emerged as multifunctional regulators of wide ranging cellular activities. miRNAs are further categorized into tumor suppressor, cancer promoting (oncomirs) and metastasis promoting (metastamirs). miRNA biology is a well orchestrated mechanism that occurs both in nucleus and cytoplasm. RNA polymerase II or III mediate transcription of pri-miRNA. It is cleaved in the nucleus by th...

Journal: :Proceedings of the National Academy of Sciences of the United States of America 2012
Ian Barr Aaron T Smith Yanqiu Chen Rachel Senturia Judith N Burstyn Feng Guo

The RNA-binding protein DiGeorge Critical Region 8 (DGCR8) and its partner nuclease Drosha are essential for processing of microRNA (miRNA) primary transcripts (pri-miRNAs) in animals. Previous work showed that DGCR8 forms a highly stable and active complex with ferric [Fe(III)] heme using two endogenous cysteines as axial ligands. Here we report that reduction of the heme iron to the ferrous [...

Journal: :Cell reports 2014
Jen Quick-Cleveland Jose P Jacob Sara H Weitz Grant Shoffner Rachel Senturia Feng Guo

Canonical primary microRNA transcripts (pri-miRNAs) are characterized by a ∼30 bp hairpin flanked by single-stranded regions. These pri-miRNAs are recognized and cleaved by the Microprocessor complex consisting of the Drosha nuclease and its obligate RNA-binding partner DGCR8. It is not well understood how the Microprocessor specifically recognizes pri-miRNA substrates. Here, we show that in ad...

نمودار تعداد نتایج جستجو در هر سال

با کلیک روی نمودار نتایج را به سال انتشار فیلتر کنید