DiGeorge syndrome critical region gene 8 (DGCR8) is the RNA-binding partner protein of the nuclease Drosha. DGCR8 and Drosha recognize and cleave primary transcripts of microRNAs (pri-miRNAs) in the maturation of canonical microRNAs (miRNAs) in animals. We previously reported that human, frog, and starfish DGCR8 bind heme when expressed in Escherichia coli and that Fe(III) heme activates apoDGC...

The Dgcr8 delta/flox mice were crossed to Zp3-Cre [1] mice and resulting offsprings were intercrossed to produce Dgcr8 ;Zp3-Cre animals. The following primers were used to genotype mice and the oocytes; P1 5’ primer, TTTCCAACCCAAGTCAGCAGAT ;P1 3’ primer, AGTGCATGTGCCATGCTGCCA; P2 5’ primer, CTGGAGTAGGCATGTTGATTTC; P2 3’ primer, CCTGATTCACTTACAACACAACC; P3 3’ primer, TAAAGCGTCCACATCATTGTC. To de...

Dgcr8 knockout cells provide a great means to understand the function of microRNAs (miRNAs) in vitro and in vivo. Current strategies to study miRNA function in Dgcr8 knockout cells depend on transient transfection of chemically synthesized miRNA mimics, which is costly and not suitable for long-term study and genetic selection of miRNA function. Here, we developed a cost-effective DGCR8-indepen...

Pluripotent stem cells (PSCs) deficient for microRNAs (miRNAs), such as Dgcr8-/- or Dicer-/- embryonic stem cells (ESCs), contain no mature miRNA and cannot differentiate into somatic cells. How miRNA deficiency causes differentiation defects remains poorly understood. Here, we report that miR-302 is sufficient to enable neural differentiation of differentiation-incompetent Dgcr8-/- ESCs. Our d...

DiGeorge syndrome chromosomal region 8 (Dgcr8), a candidate gene for 22q11.2 deletion-associated schizophrenia, encodes an essential component for microRNA (miRNA) biosynthesis that plays a pivotal role in hippocampal learning and memory. Adult neurogenesis is known to be important in hippocampus-dependent memory, but the role and molecular mechanisms of adult neurogenesis in schizophrenia rema...

Loss- and gain-of-function mutations of the X-linked gene MECP2 (methyl-CpG binding protein 2) lead to severe neurodevelopmental disorders in humans, such as Rett syndrome (RTT) and autism. MeCP2 is previously known as a transcriptional repressor by binding to methylated DNA and recruiting histone deacetylase complex (HDAC). Here, we report that MeCP2 regulates gene expression posttranscription...

In human prostate cancer, the microRNA biogenesis machinery increases with prostate cancer progression. Here, we show that deletion of the Dgcr8 gene, a critical component of this complex, inhibits tumor progression in a Pten-knockout mouse model of prostate cancer. Early stages of tumor development were unaffected, but progression to advanced prostatic intraepithelial neoplasia was severely in...

MicroRNAs have emerged as multifunctional regulators of wide ranging cellular activities. miRNAs are further categorized into tumor suppressor, cancer promoting (oncomirs) and metastasis promoting (metastamirs). miRNA biology is a well orchestrated mechanism that occurs both in nucleus and cytoplasm. RNA polymerase II or III mediate transcription of pri-miRNA. It is cleaved in the nucleus by th...

The RNA-binding protein DiGeorge Critical Region 8 (DGCR8) and its partner nuclease Drosha are essential for processing of microRNA (miRNA) primary transcripts (pri-miRNAs) in animals. Previous work showed that DGCR8 forms a highly stable and active complex with ferric [Fe(III)] heme using two endogenous cysteines as axial ligands. Here we report that reduction of the heme iron to the ferrous [...

Canonical primary microRNA transcripts (pri-miRNAs) are characterized by a ∼30 bp hairpin flanked by single-stranded regions. These pri-miRNAs are recognized and cleaved by the Microprocessor complex consisting of the Drosha nuclease and its obligate RNA-binding partner DGCR8. It is not well understood how the Microprocessor specifically recognizes pri-miRNA substrates. Here, we show that in ad...