Cytosine methylation is a widespread epigenetic regulation mechanism. In healthy mature cells, methylation occurs at CpG dinucleotides within promoters, where it primarily silences gene expression by modifying the binding affinity of transcription factors to the promoters. Conversely, a recent study showed that in stem cells and cancer cell precursors, methylation also occurs at non-CpG pairs a...

Oligodeoxynucleotides (ODN) containing unmethylated CpG dinucleotides induce proliferation of B cells and activation of macrophages and thus stimulation of the immune system. We tested an oligonucleotide containing an unmethylated CpG dinucleotide flanked by two 5' purines and two 3' pyrimidines (GAGAACGCTCGACCTTCGAT) for the ability to affect antibody levels to tetanus toxoid (Tt). Groups of m...

PURPOSE To determine how CpG, an immunostimulatory sequence, affects experimental allergic conjunctivitis and to determine the mechanisms of its action. METHODS Experimental allergic conjunctivitis was induced in mice to investigate the suppressive mechanism of CpG treatment. Cytokine profiling, fluorescence-activated cell sorting analyses, and adoptive transfer were used to analyze suppressi...

Toll-like receptor 9 (TLR9) activates the innate immune system in response to oligonucleotides rich in CpG whereas DNA lacking CpG could inhibit its activation. However, the mechanism of how TLR9 interacts with nucleic acid and becomes activated in live cells is not well understood. Here, we report on the successful implementation of single molecule tools, constituting fluorescence correlation/...

OBJECTIVE Bacterial DNA (CpG DNA) persists in tissues and blood under pathological conditions that are associated with enhanced intravascular coagulation. Toll-like receptor 9 recognizes CpG DNA and elicits innate and adoptive immunity, yet the impact of CpG DNA on coagulation has not been studied. In this study, we investigated the effects of CpG DNA on the expression and activity of tissue fa...

Neutrophils detect bacterial constituents, including bacterial DNA (CpG DNA), which elicits innate immunity and prolongs the functional life span of neutrophils through suppression of apoptosis. Both the anti-apoptotic protein Mcl-1 and activation of NF-κB have been implicated in neutrophil survival, but there is no evidence that these are linked in neutrophils. We hypothesized that CpG DNA cou...

The neurotensin/neuromedin N (NT/N) gene is expressed in fetal colon, repressed in newborn and adult colon, and reexpressed in approximately 25% of colon cancers. Our purpose was to determine the effect of gene methylation on NT/N silencing in colon cancers. We found that the NT/N gene was expressed in human colon cancer cell line KM12C but not in KM20 colon cancer cells. Bisulfite genomic sequ...