نتایج جستجو برای: mycoplasma capricolum subspecies capricolum
تعداد نتایج: 25877 فیلتر نتایج به سال:
A pneumonia outbreak reduced the numbers of a wild population of endangered markhors (Capra falconeri) in Tajikistan in 2010. The infection was diagnosed by histologic examination and bacteriologic testing. Mycoplasma capricolum subsp. capricolum was the sole infectious agent detected. Cross-species transmission from domestic goats may have occurred.
The phylogenetically related Mycoplasma capricolum subsp. capricolum and M. mycoides subsp. mycoides biotype Large Colony are two small-ruminant pathogens involved in contagious agalactia. Their respective contributions to clinical outbreaks are not well documented, because they are difficult to differentiate with the current diagnostic techniques. In order to identify DNA sequences specific to...
The ELISA and an immunoblotting technique were used to study F38-type mycoplasmas - an important cause of contagious caprine pleuropneumonia - and a number of related mycoplasma species, subspecies, types or serogroups. Two-way ELISA cross-reactivity was demonstrated between five mycoplasmas, namely strain F38, Mycoplasma mycoides subsp. mycoides (LC strain), M. equigenitalium, M. primatum and ...
Two stable RNA species and their genes have been isolated from Mycoplasma capricolum, and the nucleotide sequences have been determined by partial RNA sequencing and sequencing of the genes. The RNAs are 92 and 105 nucleotides in length, respectively. The two RNAs reveal no sequence similarity to any stable RNA so far reported, indicating that these are novel RNA species. The RNAs, designated M...
The nucleotide sequence of 5S rRNA from Mycoplasma capricolum is UUGGUGGUAUAGCAUAGAGGUCACACCUGUUCCCAUGCCGAACACAGAAGUUAAGCUCUAUUACGGUGAAGAUAUUACU GAUGUGAGAAAAUAGCAAGCUGCCAGUUOH. The length is 107 nucleotides long, and the shortest in all the 5S rRNAs so far known. The sequence is more similar to those of the gram-positive bacteria than those of the gram-negative bacteria.
The nucleotide sequence of 5S rRNA from Mycoplasma capricolum is more similar to that of the gram-positive bacteria than that of the gram-negative bacteria. The presence of two copies of rRNA genes in M. capricolum genome has been demonstrated. The two different rRNA gene clusters have been cloned in E. coli plasmid vectors and analyzed for the rRNA gene organizations, demonstrating that the ge...
Mycoplasma capricolum subsp. capripneumoniae belongs to the so-called Mycoplasma mycoides cluster and is the causal agent of contagious caprine pleuropneumonia (CCPP). All members of the M. mycoides cluster have two rRNA operons. The sequences of the 16S rRNA genes of both rRNA operons from 20 strains of M. capricolum subsp. capripneumoniae of different geographical origins in Africa and Asia w...
Latex microspheres (diameter, 8 microm) were coated with anti-Mycoplasma capricolum subsp. capripneumoniae polyclonal immunoglobulin G (IgG) antiserum (anti-F38 biotype). The coated microspheres, when used in a latex agglutination test (LAT), detected M. capricolum subsp. capripneumoniae antigen in the serum of goats with contagious caprine pleuropneumoniae (CCPP). Beads also agglutinated stron...
A new detection test for the mycoplasmas causing contagious agalactia, Mycoplasma agalactiae, M. capricolum subsp. capricolum and M. mycoides subsp. mycoides L. C., was developed. It was based on two polymerase chain reaction assays: the Ma-PCR for the detection of M. agalactiae and the MYC-PCR for the 'mycoides cluster' thus including M. capricolum subsp. capricolum and M. mycoides subsp. myco...
MCS4 RNA (125 nucleotides in length) is as abundant 5S rRNA in the cell and is encoded by two genes – mcs4a and mcs4b. We detected MCS4 RNA genes by random amplified polymorphic analysis (RAPD) and Southern hybridization technique. In our studies the genomic polymorphisms of Mycoplasma capricolum subsp. capricolum type strain California kid (ATCC 27343) and strain GM262G (ATCC 43092) were not d...
نمودار تعداد نتایج جستجو در هر سال
با کلیک روی نمودار نتایج را به سال انتشار فیلتر کنید