On the basis of the concept of the interval valued intuitionistic fuzzy sets introduced by K.Atanassov, the notion of interval valued intuitionistic fuzzyHv-submodules of anHv-module with respect to t-norm T and s-norm S is given and the characteristic properties are described. The homomorphic image and the inverse image are investigated.In particular, the connections between interval valued in...

design and expansion of distribution systems seems inevitable in view of the need to satisfy the rise in energy consumption in a technical and economical way. optimal location, sizing and determining the service area of substations is one of the principle problems in expansion of distribution systems. also uncertainty is one of the important factors that increase risk of exact decision makings....

Aerospace applications and energy-saving strategies in general raised the interest and study in the field of lightweight materials, especially on aluminum alloys. Aluminum alloy itself does not have appropriate wear resistance. Therefore, improvement of surface properties is required in practical applications, especially when aluminum is in contact with other parts. In this work, first titanium...

Design and expansion of distribution systems seems inevitable in view of the need to satisfy the rise in energy consumption in a technical and economical way. Optimal location, sizing and determining the service area of substations is one of the principle problems in expansion of distribution systems. Also uncertainty is one of the important factors that increase risk of exact decision makings....

Technical Appendix Table. PCR primer pairs used to recover whole-genome sequences of gemycircularviruses Primer pair Forward primer sequence 5′3′ Reverse primer sequence 5′3′ HV-GcV1–1 TTATATGCCCAGACGGACCC ATTGTGCGGCGGATAGGATA HV-GcV1–2 CGAATTTAACCCCGGATGCA AAGGATGCCACCCGAATGTA HV-GcV1–3 TTGTTCGATCAGACCACCGA GTTCCTTCCGAGCTACAAGT HV-GcV1–4 TCGATGTTAACTCCCTCCGG GAAACGTGTAGATCGGCGAC HV-GcV2–1 TT...