We investigated the effects of prostacyclin analogs and isoform-selective phosphodiesterase (PDE) inhibitors, alone and in combination, on pulmonary vascular remodeling in vitro and in vivo. Vascular smooth muscle cells (VSMC) isolated from pulmonary (proximal and distal) and systemic circulations demonstrated subtle variations in expression of PDE isoform mRNA. However, using biochemical assay...

We studied interactions between the mitogen-activated protein kinase (MAPK) signalling pathway and cAMP-protein kinase (PKA) signaling pathway in regulation of mitogenesis of mesangial cells (MC) determined by [3H]thymidine incorporation, with or without added EGF. Forskolin or dibutyryl cAMP strongly (by 60-70%) inhibited [3H]thymidine incorporation into MC. Cilostamide, lixazinone or cilostaz...

Background: The developmental competence of oocytes matured in vitro (IVM) is yet far below than in vivo counterparts. Recent studies suggest that the asynchrony between nuclear/cytoplasmic maturation and the initial low/heterogeneous quality of oocytes are the most important factors affecting IVM success. We investigated whether selection of growing oocytes (based on their glucose 6- phosphate...

Background: in vitro maturation (IVM) of oocytes has increasing potential applications in assisted reproductive technology (ART), during which germinal vesicle (GV) oocytes cultured in vitro to produce mature (MII arrested) ones. Although functional, IVM oocytes have low developmental competence compared to in vivo matured oocytes; possibly because IVM comprises asynchrony between nuclear and c...

PURPOSE cAMP phosphodiesterase (PDE) 4 is a family of enzymes the inhibition of which induces chronic lymphocytic leukemia (CLL) apoptosis. However, leukemic cells from a subset of CLL patients are relatively resistant to treatment with the PDE4 inhibitor rolipram, particularly when this drug is used in the absence of an adenylate cyclase stimulus such as forskolin. Elevated cAMP levels induce ...

The Dgcr8 delta/flox mice were crossed to Zp3-Cre [1] mice and resulting offsprings were intercrossed to produce Dgcr8 ;Zp3-Cre animals. The following primers were used to genotype mice and the oocytes; P1 5’ primer, TTTCCAACCCAAGTCAGCAGAT ;P1 3’ primer, AGTGCATGTGCCATGCTGCCA; P2 5’ primer, CTGGAGTAGGCATGTTGATTTC; P2 3’ primer, CCTGATTCACTTACAACACAACC; P3 3’ primer, TAAAGCGTCCACATCATTGTC. To de...

BACKGROUND It has been shown that hosphodiesterases (PDEs) play an important role in mediating the smooth muscle tone of rat urinary bladder. However, the gene expression profiles of them were still unknown. METHODS Urinary bladder Strips were obtained from both neonatal and adult Sprague-Dawley rats. RT-PCR/western blot and organ bath were used to measure the expression and function of PDEs....

Cyclic nucleotide phosphodiesterases (PDEs) hydrolyze cAMP or cGMP and terminate their signaling. Two important families of PDEs that regulate cAMP signaling in cardiovascular tissues are the cGMP-inhibited PDEs (PDE3) and the cAMP-specific PDEs (PDE4). In this study, we have used a combination of an in vitro motility assay and a sensitive method for the measurement of cAMP in order to determin...