نتایج جستجو برای: caat box
تعداد نتایج: 86655 فیلتر نتایج به سال:
The mouse lactoferrin gene promoter includes a CAAT/GT box, GGGCAATAGGGTGGGGCCAGCCC, which functions as the epidermal growth factor response element (EGFRE) in human endometrial carcinoma RL95-2 cells (RL95). A positive clone, EGFREB, of 2575 bp length, was isolated from an expression library of RL95 cells with a multimer of the EGFRE sequence. In this work, we have identified that EGFREB encod...
The genomic DNA for the alkaline protease (Alp) of the fungus Aspergillus oryzae was isolated using synthetic oligonucleotides as hydridization probes, and the complete nucleotide sequence was identified. The Alp gene is 1374 nucleotides long and contains three introns, one of which is in the pro region and two in the mature coding region. Sequences related to the TATA box (TATAAAT) and the CAA...
به منظور بررسی نقش عناصر تنظیمی سیس نواحی پروموتری بر الگوی بیان ژنهای Catalase 2 (CAT2) و Thioredoxin H5 (TRX5) در گیاه آرابیدوپسیس در پاسخ به تنشهای مختلف زیستی و غیرزیستی، توالی پروموتری ژنهای موردنظر، عناصر تنظیمی سیس موجود در آنها و دادههای مربوط به بیان این ژنها در تنشهای مختلف به ترتیب با استفاده از Phytozome، PlantCARE و The Bio-Array Resource for Plant Biology دریافت گردید.به منظور ت...
To define DNA elements involved in thiamine-regulated transcription of the Schizosaccharomyces pombe gene nmt1 (thi3), we analyzed several nmt1 promoter constructs. We detected a DNA element which is required for promoter activation in the absence of thiamine. It is located 54 to 62 bp upstream of the TATA box and matches the consensus sequence of the binding site for the mammalian transcriptio...
Autographa californica multicapsid nucleopolyhedrovirus (AcMNPV) encodes an ubiquitin protein, which may be involved in virus infection. Functional analysis of the AcMNPV ubiquitin promoter was performed by progressive deletion of sequence or mutation of putative cis-activating motifs in the promoter region. In the presence of viral factors, a transient expression assay demonstrated that the ac...
Transgenic tobacco plants carrying a fusion between the nopaline synthase (nos) promoter and chloramphenicol acetyltransferase (CAT) reporter gene (cat) were studied for their inducibility by salicylic acid (SA) or methyl jasmonate (MJ) treatments. Either chemical significantly increased CAT activity to a level much higher than that achieved by wounding. Northern blot analysis showed a correspo...
Transgenic tobacco plants carrying a fusion between the nopaline synthase (nos) promoter and chloramphenicol acetyltransferase (CAT) reporter gene (cat) were studied for their inducibility by salicylic acid (SA) or methyl jasmonate (MJ) treatments. Either chemical significantly increased CAT activity to a level much higher than that achieved by wounding. Northern blot analysis showed a correspo...
To investigate the transcriptional regulation of gene expression, chimeric fusions, between the beta-glucuronidase reporter gene (GUS) and the isolated promoter regions of the pvPDF gene (pvPDF-PRO: GUS), were constructed and introduced into Nicotiana tabacum. Analysis of transgenic pvPDF-PRO:GUS tobacco plants indicated that GUS activity was observed with all the promoter constructs with the s...
Many recent studies have shown that glycosylation patterns of Agaricus bisporus are similar to those of mammalians, so that this organism is a good candidate for the expression of glycosylated pharmaceutical protein. To achieve constant interested gene expression in all cells of the organism, proper promoter isolation is necessary. To isolate this promoter, PCR with specific primers was perform...
نمودار تعداد نتایج جستجو در هر سال
با کلیک روی نمودار نتایج را به سال انتشار فیلتر کنید