نتایج جستجو برای: allura red

تعداد نتایج: 150144  

Journal: :Catalysts 2022

Herein, we present an original report on chlorine activation by ultrasound (US: 600 kHz, 120 W) for intensifying the sonochemical treatment of hazardous organic materials. The coupling US/chlorine produced synergy via involvement reactive species (RCSs: Cl•, ClO• and Cl2•−), resulting from sono-activation chlorine. degradation Allura Red AC (ARAC) textile dye, as a contaminant model, was drasti...

Journal: :Applied and environmental microbiology 1981
K T Chung G E Fulk A W Andrews

Seventeen commonly used dyes and 16 of their metabolites or derivatives were tested in the Salmonella-mammalian microsome mutagenicity test. Mutagens active with and without added Aroclor-induced rat liver microsome preparations (S9) were 3-aminopyrene, lithol red, methylene blue (USP), methyl yellow, neutral red, and phenol red. Those mutagenic only with S9 activation were 4-aminopyrazolone, 2...

1999
Ruth Hogue Angeletti Lynda F. Bonewald Karen De Jongh

tgaacagatgatcaggtgaaatcac gtctgaaatcacgtgaaatcacgtga aaatcaccaggtgaaaaatcacgtga caggtgaaagctaacagaggggggt gacagtgctcggagaaattacaatac cgaggagaaatcctttcaatactcgag gagaaacttgacaatactagaaacttg acaatacagaaacttgacaatacag aacctgaaaaatcaatcaggtgaaa atcaatcaggtgaaatcaatcaggtg aatcacatcaggtgaaatcacatcagg tgaaatcacatcaggtgagctaacgg ggggttgacagtgctcgagaaatgttg acaatagaggagaaatttgaaatag ggagaaacttgaaatatcga...

Journal: :Mutation research 1983
K T Chung

Azo dyes are widely used in textile, printing, cosmetic, drug and food-processing industries. They are also used extensively in laboratories as either biological stains or pH indicators. The extent of such use is related to the degree of industrialization. Since intestinal cancer is more common in highly industrialized countries, a possible connection may exist between the increase in the numbe...

Journal: :Radiation protection dosimetry 2015
Sara Principi Mercè Ginjaume Maria Amor Duch Roberto M Sánchez Jose M Fernández Eliseo Vano

The equivalent dose limit for the eye lens for occupational exposure recommended by the ICRP has been reduced to 20 mSv y(-1) averaged over defined periods of 5 y, with no single year exceeding 50 mSv. The compliance with this new requirement could not be easy in some workplace such as interventional radiology and cardiology. The aim of this study is to evaluate different possible approaches in...

Journal: :Adsorption Science & Technology 2022

Allura red or Red 40 (R40) is a dye widely used in the food, textile, and pharmaceutical industries; it considered dangerous because soluble water, has high toxicity resistance to natural degradation. Several advanced wastewater treatments have been shown be effective for R40 removal but some of them present disadvantages such as by-products obtention, energy consumption, cost reactants process...

نمودار تعداد نتایج جستجو در هر سال

با کلیک روی نمودار نتایج را به سال انتشار فیلتر کنید