نتایج جستجو برای: canine
تعداد نتایج: 35102 فیلتر نتایج به سال:
Of 150 coagulase-positive staphylococcal isolates from infections in dogs, 9 isolates with biochemical properties of human biotype were characteristically agglutinated by absorbed antiserum to staphylococcal strain 17, while only 110 of 141 isolates with biochemical properties of staphylococci of canine origin were agglutinated by absorbed antiserum to strain 61218. However, upon development of...
Immunohistolocalization of carbonic anhydrase isoenzymes (CA-I, -II and -III ) in canine epididymis.
The immunolocalization of the efferent duct and the epididymis in canine was firstly examined using an the immunohistochemical method with the canine carbonic anhydrase (CA) -I, CA-II and CA-III antisera. The efferent duct was immunonegative for all present canine CA antisera. However, some slender shaped epithelial cells in the head and body segments of the epididymal duct were intensely react...
DogBAC canine BAC library (http://www.dogmap.ch/) was polymerase chain reaction (PCR)-screened. Primers were designed using canine mRNA sequence GenBank accession no. U62093 (primer UP: GACTGAGTACAAACTGGTGG and primer LO: GGGCCTCACCTCTATGGTG). The PCR conditions were established on canine blood genomic DNA, the corresponding PCR product cloned and verified by sequencing. The positive BAC clone ...
Introduction: Since the emergence of normal occlusion concept, selecting an appropriate treatment plan with or without tooth extraction has been a controversial subject. Nowadays, both methods can be successfully used for treatment of patients. However, some clinicians still believe that non-extraction orthodontic treatments have fewer complications. The purpose of this study was to evaluate de...
We report the results of a survey to determine the prevalence of canine leishmaniasis and the presence of sand flies in northwestern Italy, where autochthonous foci of canine leishmaniasis have not been reported. Active foci of canine leishmaniasis were identified, which suggests that the disease is now also endemic in continental climate areas.
Infection by a novel canine astrovirus was associated with gastroenteritis in two dogs. The virus displayed 70.3 to 73.9% amino acid identity to other canine astroviruses in the full-length capsid. Specific antibodies were detected in the convalescent-phase sera of the dogs, indicating seroconversion. Also, the virus appeared weakly related antigenically to the prototype canine astrovirus isola...
TetraPEGylated canine Hb, [SP (succinimidophenyl)-PEG5K]4-canine-Hb, with PEGylation at its four reactive cysteine residues (a111 and b93) has been prepared and characterized. The hydrodynamic volume and the molecular radius of (SP-PEG5K)4-canine-Hb are intermediate to those of di- and hexaPEGylated human Hb as expected. However, the COP (colloidal osmotic pressure) of tetraPEGylated canine Hb ...
The objective of the present study was to investigate the effects of three different culture media on the development of canine somatic cell nuclear transfer (SCNT) embryos. Canine cloned embryos were cultured in modified synthetic oviductal fluid (mSOF), porcine zygote medium-3 (PZM-3), or G1/G2 sequential media. Our results showed that the G1/G2 media yielded significantly higher morula and b...
Evidence for Canine Rehabilitation and Physical Therapy Darryl L. Millis, Ionut Alexandru Ciuperca This article reviews some important studies regarding canine physical rehabilitation. Bones, cartilage, muscles, ligaments, and tendons undergo atrophy if loading is decreased. Knowledge of the changes that occur with immobilization and the time course of events helps in the development of a rehab...
background: surveillance of the canine reservoir is highly important to help control of visceral leishmaniasis in human. it is therefore imperative to improve and develop new tools reliable, easy to use, and cheap for the diagnosis of canine leishmani asis. k39 sub recombinant antigen of leishmania infantum was expressed in prokaryotic system and evaluated for sero-diagnosis of canine visceral ...
نمودار تعداد نتایج جستجو در هر سال
با کلیک روی نمودار نتایج را به سال انتشار فیلتر کنید