The pituitary gland produces hormones that play important roles in both the development and homeostasis of the body. Ontogeny of the anterior and posterior pituitary is orchestrated by inputs from neighboring tissues, cellular signaling molecules and transcription factors. Disruption of expression or function of these factors has been implicated in the etiology of combined pituitary hormone def...

Am J Hum Genet 1994; 54: 201–13. 4 Wolff DJ, Gustashaw KM, Zurcher V et al. Deletions in Xq26.3-q27.3 including FMR1 result in a severe phenotype in a male and variable phenotypes in females depending upon the X inactivation pattern. Hum Genet 1997; 100: 256–61. 5 Anson DS, Blake DJ, Winship PR, Birnbaum D, Brownlee GG. Nullisomic deletion of the mcf.2 transforming gene in two haemophilia B pat...

Spermatogonial stem cells (SSCs) divide continuously to support spermatogenesis throughout postnatal life and transmit genetic information to the next generation. Here, we report the successful establishment of the method for the isolation and identification of human SSCs from testicular tissue, and to determine the culture conditions required to expand SSCs on human embryonic stem cell-derived...

Rett syndrome (RTT) was first described in 1966. Its biological and genetic foundations were not clear until recently when Amir et al reported that mutations in the MECP2 gene were detected in around 50% of RTT patients. In this study, we have screened the MECP2 gene for mutations in our RTT material, including nine familial cases (19 Rett girls) and 59 sporadic cases. A total of 27 sporadic RT...

Central congenital hypothyroidism (CCH) may occur in isolation, or more frequently in combination with additional pituitary hormone deficits with or without associated extrapituitary abnormalities. Although uncommon, it may be more prevalent than previously thought, affecting up to 1:16 000 neonates in the Netherlands. Since TSH is not elevated, CCH will evade diagnosis in primary, TSH-based, C...

A platypus ( Ornithorhynchus anatinus ) genomic BAC library (Clemson University Genomics Institute) was screened with a SOX3 probe amplifi ed by PCR from male platypus genomic DNA using the primers 5 CACAACTCGGAGATCAGCAA3 and 5 GTTGGTCCAGCCGTTGAC3 . Cycling parameters were: 94 ° C for 2 min, 35 cycles of 94 ° C for 30 s; 58 ° C for 30 s; 72 ° C for 1 min, then a fi nal cycle of 72 ° C for 10 mi...

Mammalian viviparity (intrauterine development of the fetus) introduced a new dimension to brain development, with the fetal hypothalamus and fetal placenta developing at a time when the fetal placenta engages hypothalamic structures of the maternal generation. Such transgenerational interactions provide a basis for ensuring optimal maternalism in the next generation. This success has depended ...

Methanol is a widely used cryoprotectant (CPA) in cryopreservation of fish embryos, however little is known about its effect at the molecular level. This study investigated the effect of methanol on sox gene and protein expression in zebrafish embryos (50% epiboly) when they were chilled for 3 h and subsequently warmed and cultured to the hatching stages. Initial experiments were carried out to...