For the success of fertilization, spindles of vertebrate oocytes must remain stable and correctly organized during the arrest in metaphase II of meiosis. Using a two-hybrid screen with MAPK as a bait, we have recently identified MISS (MAPK interacting and spindle stabilizing) which controls mouse oocyte metaphase II spindle stability. Using the same screen, we identify another MAPK partner, DOC...

Oocyte activation is an important process triggered by fertilization that initiates embryonic development. However, parthenogenetic activation can occur either spontaneously or with chemical treatments. The LT/Sv mouse strain is genetically predisposed to spontaneous activation. LT oocytes have a cell cycle defect and are ovulated at the metaphase I stage instead of metaphase II. A thorough und...

Mammalian oocytes grow and undergo meiosis within ovarian follicles. Oocytes are arrested at the first meiotic prophase, held in meiotic arrest by the surrounding follicle cells until a surge of LH from the pituitary stimulates the immature oocyte to resume meiosis. Meiotic arrest depends on a high level of cAMP within the oocyte. This cAMP is generated by the oocyte, through the stimulation of...

During early development, intracellular Ca2+ mobilization is not only essential for fertilization, but has also been implicated during other meiotic and mitotic events, such as germinal vesicle breakdown (GVBD) and nuclear envelope breakdown (NEBD). In this study, the roles of intracellular and extracellular Ca2+ were examined during meiotic maturation and reinitiation at parthenogenetic activa...

The Dgcr8 delta/flox mice were crossed to Zp3-Cre [1] mice and resulting offsprings were intercrossed to produce Dgcr8 ;Zp3-Cre animals. The following primers were used to genotype mice and the oocytes; P1 5’ primer, TTTCCAACCCAAGTCAGCAGAT ;P1 3’ primer, AGTGCATGTGCCATGCTGCCA; P2 5’ primer, CTGGAGTAGGCATGTTGATTTC; P2 3’ primer, CCTGATTCACTTACAACACAACC; P3 3’ primer, TAAAGCGTCCACATCATTGTC. To de...

Histological examination of gonadotrophin stimulated Macaca fascicularis ovaries removed at mid-follicular phase showed that germinal vesicles (GV) could exhibit different configurations in follicles greater than 1000 microns in diameter. We describe 3 types of nuclear organization called GV1 (dispersed and filamentous chromatin), GV2 (clumped and filamentous chromatin) and GV3 (perinucleolar c...

The DNA mismatch repair (MMR) family functions in a variety of contexts to preserve genome integrity in most eukaryotes. In particular, members of the MMR family are involved in the process of meiotic recombination in germ cells. MMR gene mutations in mice result in meiotic disruption during prophase I, but the extent of this disruption often differs between male and female meiocytes. To addres...

The location of the phospholipase C beta 1-isoform (PLC-beta 1) in the mouse oocyte and its role in the resumption of meiosis were examined. We used specific monoclonal antibodies to monitor the in vitro dynamics of the subcellular distribution of the enzyme from the release of the oocyte from the follicle until breakdown of the germinal vesicle (GVBD) by Western blotting, electron microscope i...

Oocyte in vitro maturation (IVM) has become a valuable technological tool for animal breeding and cloning and the treatment of human infertility because it does not require the administration of exogenous gonadotropin to obtain fertilizable oocytes. However, embryo development after IVM is lower compared to in vivo maturation, most likely because oocytes collected for IVM are heterogeneous with...

Meiotic progression in Xenopus oocytes, and all other oocytes investigated, is dependent on polyadenylation-induced translation of stockpiled maternal mRNAs. Early during meiotic resumption, phosphorylation of CPE-binding protein (CPEB) is required for polyadenylation-induced translation of mRNAs encoding cell cycle regulators. Xenopus Gef (XGef), a Rho-family guanine-exchange factor, influence...