نتایج جستجو برای: gracilis
تعداد نتایج: 3290 فیلتر نتایج به سال:
To measure regional saturation of oxygen ( rSO 2 ) of hemoglobin and total hemoglobin index (HbI) in the brain (through the molera of the head) and skeletal muscle (musculus gracilis) of conscious Chihuahua dogs using an examiner’s finger-mounted near-infrared spectroscopy (NIRS) device, Toccare, we investigated brain and skeletal muscle NIRS in 48 Chihuahuas without severe disease. To measure ...
BACKGROUND Free and pedicled medial and lateral thigh-based flaps are common reconstructive procedures. However, there have been no comparative studies of morbidity between medial and lateral donor sites. METHODS We conducted an Enterprise Data Warehouse-based review of all the senior authors' (R.D.G., G.A.D., and M.S.A.) thigh-based free and pedicled flaps. Patient demographic data, donor-si...
Kozma, Fruzsina, Robert A. Johnson, Fan Zhang, Changhua Yu, Xianglan Tong, and Alberto Nasjletti. Contribution of endogenous carbon monoxide to regulation of diameter in resistance vessels. Am. J. Physiol. 276 (Regulatory Integrative Comp. Physiol. 45): R1087–R1094, 1999.— Endogenous carbon monoxide was proposed to subserve vasodepressor functions. If so, inhibition of heme oxygenase may be exp...
Campylobacter species are important organisms in both human and animal health. The identification of Campylobacter currently requires the growth of organisms from complex samples and biochemical identification. In many cases, the condition of the sample being tested and/or the fastidious nature of many Campylobacter species has limited the detection of campylobacters in a laboratory setting. To...
Pelvic and hindlimb myology of the basal Archosaur Poposaurus gracilis (Archosauria: Poposauroidea).
The discovery of a largely complete and well preserved specimen of Poposaurus gracilis has provided the opportunity to generate the first phylogenetically based reconstruction of pelvic and hindlimb musculature of an extinct nondinosaurian archosaur. As in dinosaurs, multiple lineages of basal archosaurs convergently evolved parasagittally erect limbs. However, in contrast to the laterally proj...
In most teleost fishes, the optic nerves decussate completely as they project to the mesencephalic region. Examination of the decussation pattern of 25 species from 11 different orders in Pisces revealed that each species shows a specific chiasmic type. In 11 species out of the 25, laterality of the chiasmic pattern was not determined; in half of the individuals examined, the left optic nerve r...
The nucleotide sequence of 5S rRNA from Porphyra yezoensis has been determined to be: pACGUACGGCCAUAUCCGAGACACGCGUACCGGAACCCAUUCCGAAUUCCGAAGUCAAGCGUCCGCGAGUUGGGUUAGU - AAUCUGGUGAAAGAUCACAGGCGAACCCCCAAUGCUGUACGUC. This 5S rRNA sequence is most similar to that of Euglena gracilis (63% homology).
The purpose of this study was to investigate the adverse effects of ultraviolet (UV) radiation on earthworms. Earthworms that crawl out of the soil may die within a few hours after sunrise. This study shows that UV exposure can be lethal. In general, UV-B had a stronger damaging effect than UV-A. Different species of earthworms had different tolerances to UV exposure. In this study, Pontoscolex...
Vascular smooth muscle (VSM) transmembrane potentials (Em) were measured in situ in small branch arteries (150-300-microns o.d.), small branch veins (300-400-microns o.d.), arterioles (90-150-microns o.d.), and venules (80-250-microns o.d.) in the mesenteric and gracilis muscle and the arterioles and venules of cremaster muscle vascular beds in anesthetized rats with reduced renal mass hyperten...
Ricinoleic acid (RA), a hydroxyl fatty acid, is suitable for medical and industrial uses and is produced in high-oil-accumulating organisms such as castor bean and the ergot fungus Claviceps. We report here the efficient production of RA in a transgenic diatom Chaetoceros gracilis expressing the fatty acid hydroxylase gene (CpFAH) from Claviceps purpurea. In transgenic C. gracilis, RA content i...
نمودار تعداد نتایج جستجو در هر سال
با کلیک روی نمودار نتایج را به سال انتشار فیلتر کنید