Compared to standard treatments for various diseases, photochemotherapy and photo-dynamic therapy are less invasive approaches, in which DNA photocleavers represent promising tools for novel "on demand" chemotherapeutics. A series of p-nitrobenzoyl and p-pyridoyl ester conjugated aldoximes, amidoximes and ethanone oximes were subjected to UV irradiation at 312 nm with supercoiled circular plasm...

BACKGROUND & OBJECTIVES Human papillomavirus (HPV) is the necessary cause of cervical cancer and Chlamydia trachomatis (CT) is considered a potential cofactor in the development of cervical intraepithelial neoplasia (CIN). The objective of this pilot study was to determine the association of CT infection with HPV, other risk factors for cervical cancer, and CIN in symptomatic women. METHODS A...

Here, we show that DNA-mediated charge transport (CT) can lead to the oxidation of thiols to form disulfide bonds in DNA. DNA assemblies were prepared possessing anthraquinone (AQ) as a photooxidant spatially separated on the duplex from two SH groups incorporated into the DNA backbone. Upon AQ irradiation, HPLC analysis reveals DNA ligated through a disulfide. The reaction efficiency is seen t...

The interaction of an organophosphorus insecticide methylparathion (O,O-dimethyl O-4-nitrophenyl phosphorothioate) with double-stranded DNA was characterized by UV and circular dichroism (CD) spectroscopy. Two kinds of DNA were employed: calf thymus DNA (CT DNA) and a synthetic two-stranded oligomer of sequence 5'-d(TTGGATCCGAATTCAAGCTT)-3'. Melting curves and CD spectra were taken for the DNAs...

in depth interaction studies between calf thymus deoxyribonucleic acid (ct-dna) and a series of four structurally relative palladium(ii) complexes [pd(en)(hb)](no3)2 (a-d), where en is ethylenediamine and heterocyclic base (hb) is 2,2'-bipyridine (bpy, a); 1,10-phenanthroline (phen, b); dipyridoquinoxaline (dpq, c) and dipyridophenazine (dppz, d) (figure 1), were performed. these studies h...

NY-ESO-1 is a cancer/testis (CT) antigen expressed in normal adult tissues solely in the testicular germ cells of normal adults and in various cancers. It induces specific humoral and cellular immunity in patients with NY-ESO-1-expressing cancer. We compared the expression of NY-ESO-1 mRNA in hepatocellular carcinoma (HCC) patients by using various primers and DNA polymerases to optimize RT-PCR...

introduction: mandibular fracture is the most common facial bone fracture due to facial trauma. a variety of imagings have been used for diagnosis of mandibular fractures. however, the choice of imaging for diagnosis of mandibular fractures is controversial.present study compares the accuracy of the three most common imaging methods in mandibular fracture diagnosis panoramic radiography, corona...

The interactions of the parent complexes [AuCl(Terpy)]Cl(2) and [PtCl(Terpy)]Cl with DNA were analysed by various physicochemical methods. Surprisingly, these metal complexes produce different interaction patterns with DNA in spite of their profound structural similarity. Indeed, important modifications are detected in the characteristic UV-Vis bands of [PtCl(Terpy)]Cl upon addition of ct-DNA, ...

Polypyridyl based ruthenium(II) complexes, [Ru(bpy)2(furphen)](PF6)2 (1) and [Ru(bpy)2(imiphen)](PF6)2 (2) {furphen: 2-(furan-2-yl)-1H-imidazo[4,5-f][1,10]phenanthroline and imiphen: 2-(1H-imidazol-2-yl)-1H-imidazo[4,5-f][1,10]phenanthroline} were synthesized and characterized by ESI-MS, NMR, UV-Visible and fluorescence spectroscopic techniques. The interaction of Ru(II) complexes with calf-thy...