Introduction. Polymerase chain reaction (PCR)-based diagnostic tests use purifi ed nucleic acids (NAs) from clinical samples. The NAs cation step adds time, cost, and aff ects the quality of testing. objective this study was to develop a protocol for direct saliva in genetic markers, without acids. Methods. PCR, real-time RT-PCR isothermal amplifi were used detection Results. We report markers ...

Bacterial blight (Xanthomonas arboricola pv.juglandis) is one of the main diseases of walnut that reduce the yield in the central, western and northern regions of Iran. This disease was first reported form, Qazvin and Mazandaran, then widely reported from northern, central and western provinces. To identify the cause of the disease in different provinces, infected leaves collected from Alborze,...

We here identified for the first time the presence of Mycobacterium avium paratuberculosis (MAP) sheep (S) strain in Argentina. IS900 polymerase chain reaction (PCR) was positive. The S strain was compared with MAP cattle (C) strains by using IS1311 PCR-restriction endonuclease analysis (PCR-REA), multiplex PCR and restriction fragment length polymorphism (RFLP) analysis.

DogBAC canine BAC library (http://www.dogmap.ch/) was polymerase chain reaction (PCR)-screened. Primers were designed using canine mRNA sequence GenBank accession no. U62093 (primer UP: GACTGAGTACAAACTGGTGG and primer LO: GGGCCTCACCTCTATGGTG). The PCR conditions were established on canine blood genomic DNA, the corresponding PCR product cloned and verified by sequencing. The positive BAC clone ...

Klebsiella pneumoniae and Haemophilus influenzae are two common pathogens associated with respiratory tract infections. The identification of these pathogens using conventional molecular diagnostic tests requires trained personnel, cold-chain transportation, and storage-dependance, which does not render them user-friendly. The aim of this study was to develop a thermostabilized, cold-chain-free...

Incidence of human herpesvirus-6 (HHV-6) infection in the neonatal period has been reported few cases. HHV-6, commonly responsible for roseola, is known to establish during infancy and early childhood. A 14-day-old neonate, presented with a fever 38.3℃, primarily due an HHV-6 infection, was admitted our intensive care unit. polymerase chain reaction (PCR) his cerebrospinal fluid positive HHV-6....

ABSTRACT Chagas disease, caused by the protozoan Trypanosoma cruzi, has often been linked to oral transmission through açai consumption. Molecular methods that allow fast and accurate identification of pathogen are important for detection presence parasite in this food. This study aimed optimize polymerase chain reaction (PCR)-based T. cruzi DNA pulp. Several dilutions DTU TcI trypomastigote fo...

Plant diseases caused by numerous pathogens such as bacteria, viruses, and fungi are responsible for substantial economic losses in the agricultural industry worldwide. Specific, sensitive, efficient diagnostic tools have been developed worldwide to mitigate prevent pathogenic threat. The revolutionized from classical methods more advanced molecular approaches enzyme-linked immunosorbent assay ...