BACKGROUND Translating Emergency Knowledge for Kids was established to bridge the research-practice gap in pediatric emergency care by bringing the best evidence to Canadian general emergency departments (EDs). The first step in this process was to conduct a national needs assessment to determine the information needs and preferences of health professionals and parents in this clinical setting....

We report monitoring of the 0.3–10 keV spectrum of NGC 4258 with the the XMM-Newton Observatory at five epochs over 1.5 years. We also report reprocessing of an overlapping four-epoch series of archival Chandra observations (0.5– 10 keV). By including earlier ASCA and Beppo-SAX observations, we present a new, nine-year time-series of models fit to the X-ray spectrum of NGC 4258. We model the Ch...

We introduce a probabilistic approach to the problem of counting dwarf satellites around host galaxies in databases with limited redshift information. This technique is used to investigate the occurrence of satellites with luminosities similar to the Magellanic Clouds around hosts with properties similar to the Milky Way (MW) in the object catalog of the Sloan Digital Sky Survey (SDSS). Our ana...

Content-Based Image Retrieval (CBIR) is an important problem in the domain of digital data management. There is indeed a growing availability of images, but unfortunately the traditional metadata-based search systems are unable to properly exploit their visual information content. In this article we introduce a novel CBIR scheme that abstracts each image in the database in terms of statistical ...

BACKGROUND An impairment of CO diffusing capacity has been shown in diabetic patients without lung disease. We analyzed how diffusing capacity in patients with COPD is affected by the concurrent diagnosis of diabetes. METHODS Data from the initial visit of the German COPD cohort COSYCONET were used for analysis. 2575 patients with complete lung function data were included, among them 358 defi...

TeV-blazars are known as prominent non-thermal emitters across the entire electromagnetic spectrum with their photon power peaking in the X-ray and TeVband. If distant, absorption of γ-ray photons by the extragalactic background light (EBL) alters the intrinsic TeV spectral shape, thereby affecting the overall interpretation. Suzaku observations for two of the more distant TeV-blazars known to ...

The mouse lactoferrin gene promoter includes a CAAT/GT box, GGGCAATAGGGTGGGGCCAGCCC, which functions as the epidermal growth factor response element (EGFRE) in human endometrial carcinoma RL95-2 cells (RL95). A positive clone, EGFREB, of 2575 bp length, was isolated from an expression library of RL95 cells with a multimer of the EGFRE sequence. In this work, we have identified that EGFREB encod...

OBJECTIVES To assess changes between 1990 and 2000 in the circumstances of women who became mothers before the age of 18. DESIGN Two cross sectional probability sample surveys of the general population carried out in 1989-1991 (Natsal 1990) and 1999-2001 (Natsal 2000). SETTING British households. PARTICIPANTS Women aged 18 to 27 years at time of survey (Natsal 1990: 2575, Natsal 2000: 175...

BACKGROUND Filamentous fungi are the most widely used eukaryotic biocatalysts in industrial and chemical applications. Consequently, there is tremendous interest in methodology that can use the power of genetics to develop strains with improved performance. For example, Metarhizium anisopliae is a broad host range entomopathogenic fungus currently under intensive investigation as a biologically...

At z = 0.1055, the gamma-ray burst GRB 031203 is one of the two nearest GRBs known. Using observations from the Very Large Array (VLA) and Chandra X-ray Observatory we derive sub-arcsecond localizations of the radio and X-ray afterglow of this GRB. We present near-infrared observations of the supernova SN 2003lw, which exploded in the host galaxy of the GRB 031203. Our deep, high resolution Mag...