The adhesion of copper films to adjacent device layers including TiN, Ta, and TaN diffusion barriers is a crucial reliability issue for integrated circuits. We report that ultrathin layers of poly(acrylic acid) (PAA) prepared on barrier surfaces or on the native oxide of Si wafers dramatically increase the interfacial adhesion of Cu films deposited by the H2 assisted reduction of bis(2,2,7-trim...

In this paper active screen plasma nitriding (ASPN) is used to chemically modify the surface of UHMWPE. This is an unexplored and new area of research. ASPN allows the homogeneous treatment of any shape or surface at low temperature; therefore, it was thought that ASPN would be an effective technique to modify organic polymer surfaces. ASPN experiments were carried out at 120 °C using a dc plas...

Ti-TiC-TiC/diamond-like carbon (DLC) gradient nano-composite films have been prepared on NiTi alloy substrates by the technique of plasma immersion ion implantation and deposition (PIIID) combined with plasma-enhanced chemical vapor deposition (PECVD). The influence of negative bias voltage applied to the substrate (from -100 V to -500 V) on the chemical structure, microstructure, mechanical pr...

The development of cisplatin and Pt-based analogues anticancer agents requires knowledge concerning the molecular mechanisms of interaction between such drugs with DNA. However, the binding dynamics and kinetics of cisplatin reactions with DNA determined by traditional approaches are far from satisfactory. In this study, a typical 20-base oligonucleotide (CGTGACAGTTATTGCAGGCG), as a simplified ...

The growth of Cobalt oxides by reactive thermal evaporation of metallic Cobalt in an oxygen atmosphere on a series of oxide substrates, namely SiO2, Al2O3 and MgO, has been chemically and morphologically studied by means of XPS and atomic force microscopy (AFM). The XPS results reveal that cobalt oxide grows as CoO (Co) for coverages up to some tens of equivalent monolayers on all substrates. F...

The initial quality and stability in air of InAs(001) surfaces passivated by a weakly-basic solution of thioacetamide (CH3CSNH2) is examined by XPS. The S-passivated InAs(001) surface can be modeled as a sulfur-indium-arsenic ‘layer-cake’ structure, such that characterization requires quantification of both arsenic oxide and sulfur layers that are at most a few monolayers thick. This thickness ...

The surface composition of as-grown and annealed ZnO nanorods arrays (ZNAs) grown by a two-steps chemical bath deposition method has been investigated by Xray photoelectron spectroscopy (XPS). XPS confirms the presence of OH bonds and specific chemisorbed oxygen on the surface of ZNAs, as well as H bonds on 0) 1 (10 surfaces which has been first time observed in the XPS spectra. The experimenta...