The structures that can be implemented and the materials that are used in complementary metal-oxide semiconductor (CMOS) integrated circuit (IC) technology are optimized for electronic performance. However, they are also suitable for manipulating and detecting optical signals. In this paper, we show that while CMOS scaling trends are motivated by improved electronic performance, they are also c...

Technical Appendix Table. PCR primer pairs used to recover whole-genome sequences of gemycircularviruses Primer pair Forward primer sequence 5′3′ Reverse primer sequence 5′3′ HV-GcV1–1 TTATATGCCCAGACGGACCC ATTGTGCGGCGGATAGGATA HV-GcV1–2 CGAATTTAACCCCGGATGCA AAGGATGCCACCCGAATGTA HV-GcV1–3 TTGTTCGATCAGACCACCGA GTTCCTTCCGAGCTACAAGT HV-GcV1–4 TCGATGTTAACTCCCTCCGG GAAACGTGTAGATCGGCGAC HV-GcV2–1 TT...

This brief presents a novel level-shifter circuit for high-frequency high-voltage (HV) gate-drives. The proposed level shifter (LS) is designed based on capacitive-coupler/current mirror/ latch structure which helps to extend operation voltage of floating supply into the negative range, achieves sub-ns and constant delay, consumes very low power from supply. Additionally, common-mode noise canc...

Beginning with a brief review of CMOS scaling trends from 1 m to 0.1 m, this paper examines the fundamental factors that will ultimately limit CMOS scaling and considers the design issues near the limit of scaling. The fundamental limiting factors are electron thermal energy, tunneling leakage through gate oxide, and 2D electrostatic scale length. Both the standby power and the active power of ...

An ASIC implementation of capacitive fingerprint sensor is described for user authentication on small, thin, and portable equipment. New charge sharing sensing circuit minimizes the influence of internal parasitic capacitances and enlarges the voltage difference between a ridge and valley. A voltage comparator can easily discriminate a ridge and valley. Our method results in about 180% improvem...

Objectives Cerebral microbleeds (CMBs) are often observed in memory clinic patients. It has been generally accepted that deep CMBs (D-CMBs) result from hypertensive vasculopathy (HV), whereas strictly lobar CMBs (SL-CMBs) result from cerebral amyloid angiopathy (CAA) which frequently coexists with Alzheimer's disease (AD). Mixed CMBs (M-CMBs) have been partially attributed to HV and also partia...

Mechanical ventilation with high tidal volumes (HV(T)) impairs lung liquid clearance (LLC) and downregulates alveolar epithelial Na-K-ATPase. We have previously reported that the Na-K-ATPase alpha(2)-subunit contributes to LLC in normal rat lungs. Here we tested whether overexpression of Na-K-ATPase alpha(2)-subunit in the alveolar epithelium would increase clearance in a HV(T) model of lung in...