The electronic properties (such as energy gap HOMO levels. LUMO levels, density of state and bonds in addition to spectroscopic like IR spectra, Raman force constant reduced masses a function frequency) coronene C24 graphene oxide C24OX , where x=1-5, were studied.. methodology employed was Density Functional Theory (DFT) with Hybrid B3LYP 6-311G** basis sets. calculated for be 3.5 eV C24Ox fro...

Blinder-Oaxaca Decomposition for Tobit Models In this paper, a decomposition method for Tobit-models is derived, which allows the differences in a censored outcome variable between two groups to be decomposed into a part that is explained by differences in observed characteristics and a part attributable to differences in the estimated coefficients. The method is applied to a decomposition of t...

Using a rich panel data set, we provide a rigorous analysis of the relationship between access to external finance, foreign direct investment and the exports of private enterprises in China. We conclude that, in order to foster the exports of indigenous enterprises, the elimination of financial discrimination against private firms is likely to be a more effective policy tool than the reliance o...

The targeted adduction of aflatoxin B1- exo -8,9-epoxide (AFB1- exo -8,9-epoxide) to a specific guanine within an oligodeoxyribonucleotide containing multiple guanines was achieved using a DNA triplex to control sequence selectivity. The oligodeoxyribonucleotide d(AGAGAAGATTTTCTTCTCTTTTTTTTCTCTT), designated '3G', spontaneously formed a triplex in which nucleotides C27*G2*C18 and C29*G4*C16 for...

Synthesis of VLCFAs (very long chain fatty acids) and biosynthesis of DHS (dihydrosphingosine) both are of vital importance for Saccharomyces cerevisiae. The bulk of VLCFAs and DHS are used for ceramide synthesis by the Lag1p (longevity-assurance gene 1)/Lac1p (longevity-assurance gene cognate 1)/Lip1p (Lag1p/Lac1p interacting protein) ceramide synthase. LAG1 and LAC1 are redundant but LIP1 is ...

Shiga toxins (Stxs) are produced by enterohemorrhagic Escherichia coli (EHEC), which cause human infections with an often fatal outcome. Vero cell lines, derived from African green monkey kidney, represent the gold standard for determining the cytotoxic effects of Stxs. Despite their global use, knowledge about the exact structures of the Stx receptor glycosphingolipids (GSLs) and their assembl...

The role of the C24 sulphate in the mating pheromone component, 7α,12α,24-trihydroxy-5α-cholan-3-one 24-sulphate (3kPZS), to specifically induce upstream movement in ovulated female sea lampreys Petromyzon marinus was investigated. 7α,12α-dihydroxy-5α-cholan-3-one 24-oic acid (3kACA), a structurally similar bile acid released by spermiated males, but lacking the C24 sulphate ester, was tested i...

Two fused cyclopentadithiophenebis(dicyanovinylene) derivatives (FCPDT-16 and FCPDT-C24) with a low-lying LUMO energy level (3.88 eV) and a rigid core structurewere successfully synthesized.They have good thermal stability and form highly ordered packing structures both in the bulk solid state and in thin films. The field effect transistors fabricated from a solution of these two compounds show...