نتایج جستجو برای: 5183 and 4749
تعداد نتایج: 16827196 فیلتر نتایج به سال:
the purpose of this study was to investigate the relationship between family functioning and marital adjustment humor couples are due to the nature and objectives of the research and application of methods for its implementation correlation was used. the study population consisted of all the couples in the city who uses random cluster sampling of 200 students were selected as sample. data from ...
the subjects of the study are only the tefl teachers and students at gilan university. to obtain the desired data, a questionnaire which was based on the theories and disecussions gathered, was used as the main data gathering instrument. to determine the degree of relationship between variables, covariance and pearson product moment correlation coefficient were the formulas applied. the data we...
oxidative addition reactions of 1,4-diiodo-butane and 1,3-diiodo-propane with [ptme2(ph2phen)]; in which ph2phen=4,7-diphenyl-1,10-phenanthroline, were studied in different solvents such as acetone and benzene.oxidative addition reaction of [pt me2(ph2phen)] with i(ch2)4i and i(ch2)3i produced the [pt me2i(ch2)4(ph2phen)i] (1a) and [pt me2i(ch2)3(ph2phen)i] (1b).all the platinum (iv) products w...
abstract i the purpose of this study was to launch a thorough investigation concerning the possibility of differing orientations to the writing proficiency construct by native and non-native english speaking teacher raters. it mainly revolved around the international english language testing system (ielts) that is widely administered and employed as a measure of general proficiency in englis...
the purpose of the present study is to find out whether bilinguals of khuzestan-arab origin or monolinguals of iranian origin code-switch during learning or speaking english and which group is more susceptible to code-switch. to this end, the students of 24 classes from high schools and pre- university centers were screened out, and interviewed and their voices and code-switchings were recorded...
abstract due to the growing importance and influence of the self of the teacher in the field of educational and cognitive psychology, the current study intended to investigate the relationship between three teacher qualities and characteristics, i.e. teacher self efficacy, self regulation, and success as perceived by their learners. the study aimed at finding whether teacher self efficacy an...
flow in natural river bends is a complex and turbulent phenomenon which affects the scour and sedimentations and causes an irregular bed topography on the bed. for the reason, the flow hydralics and the parameters which affect the flow to be studied and understand. in this study the effect of bed and wall roughness using the software fluent discussed in a sharp 90-degree flume bend with 40.3cm ...
به منظور جمع آوری و شناسایی کنه های بالاخانواده ی raphignathoidea باغات و مزارع شهرستان های ماکو و چایپاره، نمونه برداری هایی در فصل زراعی سال 1391 از خاک و اندام های هوایی صورت گرفت. در این مطالعه حدود 1200 اسلاید تهیه گردید که منجر به شناسایی 5 خانواده، 11 جنس و 31 گونه متعلق به بالا خانواده ی raphignathoidea گردید. از بین این تعداد 7 گونه برای فون دنیا و 8 گونه برای فون کنه های استان آذربایج...
cultural iran is a scope that is more extended than the political territories of iran as a political unit. this concept means that cultural geography(mehdi moghanlo-1383-1) of iran is greater than its political geography which, according to history, has a long history extending west-east from kandahar to the euphrates and north-south from the persian gulf to the caucasus including transoxiana a...
Table 1. Primers used for amplification and sequencing of the ferret HEV genome* Primer Sequence, 5 3 Nucleotide position† FRHEV-F1 GGCTGGCGTTTGCTTGGAGG 256–275 FRHEV-R1 TTCGAATCCAACGCTGGTGAC 1158–1178 FRHEV-F2 GTACTATCACGGCCAATGAG 1077–1096 FRHEV-R2 CAGCCTATAGGGCATAGTAAG 1681–1701 FRHEV-F3 GCCCTGACCTTGGAGCTGAC 1592–1611 FRHEV-R3 CTATTGGCGGCGTTAACTAG 2078–2097 FRHEV-F4 GAGCTTTTGCCGGATGGGTC 2015...
نمودار تعداد نتایج جستجو در هر سال
با کلیک روی نمودار نتایج را به سال انتشار فیلتر کنید