نتایج جستجو برای: اجرای تکنیک 5s
تعداد نتایج: 67688 فیلتر نتایج به سال:
Ribosomal DNA in sturgeon is informative when analyzed at the molecular level because it bears unique characteristics that are, to a certain extent, ancestral within vertebrates. In this paper, we examine the structure and the molecular evolution of the 5S ribosomal DNA (rDNA) region in 13 sturgeon species, comparing both the 5S ribosomal RNA (rRNA) genes and the non-transcribed spacer (NTS) se...
We investigated the locations of 5S and 45S rDNA in Gossypium diploid A, B, D, E, F, G genomes and tetraploid genome (AD) using multi-probe fluorescent in situ hybridization (FISH) for evolution analysis in Gossypium genus. The rDNA numbers and sizes, and synteny relationships between 5S and 45S were revealed using 5S and 45S as double-probe for all species, and the rDNA-bearing chromosomes wer...
A general secondary structure is proposed for the 5S RNA of prokaryotic ribosomes, based on helical energy filtering calculations. We have considered all secondary structures that are common to 17 different prokaryotic 5S RNAs and for each 5S sequence calculated the (global) minimum energy secondary structure (300,000 common structures are possible for each sequence). The 17 different minimum e...
We review all instances in which the nuclear 5S rRNA genes of fungi, protist, nematode, and arthropod species have been reported to be linked to the tandemly repeated units of the rDNA, trans-spliced leader, and histone multigene families. The evolution of these gene arrangements is analyzed by mapping them to independently derived phylogenies. These analyses show that 5S rRNA genes have repeat...
The nucleotide sequence of 5S rRNA from Porphyra yezoensis has been determined to be: pACGUACGGCCAUAUCCGAGACACGCGUACCGGAACCCAUUCCGAAUUCCGAAGUCAAGCGUCCGCGAGUUGGGUUAGU - AAUCUGGUGAAAGAUCACAGGCGAACCCCCAAUGCUGUACGUC. This 5S rRNA sequence is most similar to that of Euglena gracilis (63% homology).
A novel nested PCR assay was developed to detectRickettsiaspp. in ticks and tissue samples from humans and laboratory animals. Primers were designed for the nested run to amplify a variable region of the 23S-5S intergenic spacer (IGS) ofRickettsiaspp. The newly designed primers were evaluated using genomic DNA from 11Rickettsiaspecies belonging to the spotted fever, typhus, and ancestral groups...
The chromatin-remodelling complex B-WICH, comprised of William syndrome transcription factor, the ATPase SNF2h and nuclear myosin, specifically activates RNA polymerase III transcription of the 5S rRNA and 7SL genes. However, the underlying mechanism is unknown. Using high-resolution MN walking we demonstrate here that B-WICH changes the chromatin structure in the vicinity of the 5S rRNA and 7S...
From a cluster of structural rRNA genes which has previously been cloned (Hwang and Kim, in submiddion; J. Microbiol Biotechnol.), a 1.0-kb EcoRI fragment of DNA which shows significant homology to the 25S and 5S rRNAs of Tricholoma matsutake was used for sequence analysis. Nucleotide sequence was biditectionally determined using deletion series of the DNA fragment. Comparing the resultant 1016...
We have used network analysis to study gene sequences of the Triticum and Aegilops 5S rDNA arrays, as well as the spacers of the 5S-DNA-A1 and 5S-DNA-2 loci. Network analysis describes relationships between 5S rDNA sequences in a more realistic fashion than conventional tree building because it makes fewer assumptions about the direction of evolution, the extent of sexual isolation, and the pat...
In vivo, histone H1 plays an active role in establishing the transcriptionally repressed chromatin state of the oocyte-type 5S RNA genes in the early stages of Xenopus development. By using fully defined in vitro system of chromatin assembly on plasmids with cloned oocyte- or somatic-type 5S gene repeats we found that the oocyte repeat which comprises a 120 bp oocyte-type 5S RNA gene placed wit...
نمودار تعداد نتایج جستجو در هر سال
با کلیک روی نمودار نتایج را به سال انتشار فیلتر کنید