The organisms studied were those of the family Micrococcaceae which cannot participate in genetic exchange with Micrococcus luteus and those whose biochemical and physiological characteristics appear to bridge the genera Staphylococcus and Micrococcus. The hydrocarbon compositions of M. luteus ATCC 4698 and Micrococcus sp. ATCC 398 were shown to be similar to those previously reported for many ...

Ergosterol biosynthesis pathways essential to pathogenic protozoa growth and absent from the human host offer new chokepoint targets. Here, we present characterization and cell-based interference of Acanthamoeba spp sterol 24-/28-methylases (SMTs) that catalyze the committed step in C28- and C29-sterol synthesis. Intriguingly, our kinetic analyses suggest that 24-SMT prefers plant cycloartenol ...

Educational Qualifications and Wage Inequality: Evidence for Europe This paper explores the connection between education and wage inequality in nine European countries. We exploit the quantile regression technique to calculate returns to lower secondary, upper secondary and tertiary education at different points of the wage distribution. We find that returns to tertiary education are highly inc...

The targeted adduction of aflatoxin B1- exo -8,9-epoxide (AFB1- exo -8,9-epoxide) to a specific guanine within an oligodeoxyribonucleotide containing multiple guanines was achieved using a DNA triplex to control sequence selectivity. The oligodeoxyribonucleotide d(AGAGAAGATTTTCTTCTCTTTTTTTTCTCTT), designated '3G', spontaneously formed a triplex in which nucleotides C27*G2*C18 and C29*G4*C16 for...

Recent studies of Toxoplasma gondii isolates from animals in Brazil have revealed high genetic diversity. Many of these isolates are virulent to mice. It is speculated that these isolates may also be virulent to humans. However, there is very limited data regarding T. gondii strains from human infection. Therefore, it is not clear whether there is any association between parasite genotypes and ...

The role of rodents in the epidemiology of toxoplasmosis was investigated in Londrina, Paraná State, Brazil. One hundred and eighty-one Rattus rattus and one Mus musculus were caught in 37 places. Blood and tissues were collected and submitted to the indirect fluorescence antibody test (IFAT) and the bioassay. Serum samples from 61 contacting dogs were also collected. Sixteen rats (8.8%) were p...

We characterized a new cytochrome P450 monooxygenase (P450), CYP724B2, from tomato (Lycopersicon esculentum). CYP724B2 showed 42% and 62% amino acid sequence identity with Arabidopsis DWARF4/CYP90B1 and rice DWARF11/CYP724B1 respectively. Functional assay of CYP724B2 heterologously expressed in insect cells revealed that CYP724B2 catalyzes C-22 hydroxylation of campesterol, indicating that CYP7...

Microorganisms in terrestrial and marine ecosystems are essential to environmental sustainability. In the marine environment, invertebrates often depend on metabolic cooperation with their endosymbionts. Coral reefs, one of the most important marine ecosystems, are based on the symbiosis between a broad diversity of dinoflagellates of the genus Symbiodinium and a wide phyletic diversity of host...

Dogs are considered a potential risk for transmission of Toxoplasma gondii to humans because they can mechanically transmit oocysts to people and in certain parts of the world dog meat is consumed by humans. The prevalence of T. gondii in 42 dogs from rural Vietnam was determined. Antibodies to T. gondii were assayed by the modified agglutination test, and found in 21 (50%) of 42 dogs with tite...

Until recently, Toxoplasma gondii was considered clonal with very little genetic variability. Recent studies indicate that T. gondii isolates from Brazil are genetically and biologically different from T. gondii isolates from USA and Europe. In the present study, we retyped 151 free range chicken isolates from Brazil including 117 newly isolated samples from 11 geographically areas (Alagoas, Ba...