نتایج جستجو برای: tgm
تعداد نتایج: 187 فیلتر نتایج به سال:
PURPOSE To determine the impact of substratum stiffness and latrunculin-B (Lat-B), on the expression of several matrix proteins that are associated with glaucoma. METHODS Human trabecular meshwork (HTM) cells were cultured on hydrogels possessing stiffness values mimicking those found in normal (5 kPa) and glaucomatous meshworks (75 kPa), or tissue culture polystyrene (TCP; >1 GPa). Cells wer...
In a recent phase I clinical trial, a vaccine consisting of glypican-3 (GPC3)-derived CTL epitopes was found to be safe and induced measurable immune and clinical responses in patients with hepatocellular carcinoma (HCC). The aim of this study was to identify GPC3-derived long peptides (GPC3-LPs) carrying promiscuous HLA class II-restricted T helper (Th) cell epitopes. Using a computer algorith...
The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR...
BACKGROUND 2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD) is a potent activator of the aryl hydrocarbon receptor (AhR) and causes chloracne in humans. The pathogenesis and role of AhR in chloracne remains incompletely understood. OBJECTIVE To elucidate the mechanisms contributing to the development of the chloracne-like phenotype in a human epidermal equivalent model and identify potential biomar...
Active-site-specific chaperone therapy for Fabry disease is a genotype-specific therapy using a competitive inhibitor, 1-deoxygalactonojirimycin (DGJ). To elucidate the mechanism of enhancing alpha-galactosidase A (alpha-Gal A) activity by DGJ-treatment, we studied the degradation of a mutant protein and the effect of DGJ in the endoplasmic reticulum (ER). We first established an in vitro trans...
In conclusion, BSI is a rare genodermatosis belonging to the group of ARCI. It has a series of clinical and diagnostic peculiarities that we should be aware of. Although the diagnosis is usually clinical, confirmation can only be made by genetic analysis of the TGM-1 gene. This is the only gene implicated in this condition, but its mutations are also the most prevalent in other forms of ARCI, a...
نمودار تعداد نتایج جستجو در هر سال
با کلیک روی نمودار نتایج را به سال انتشار فیلتر کنید