نتایج جستجو برای: tgm

تعداد نتایج: 187  

Journal: :Investigative ophthalmology & visual science 2012
Sara M Thomasy Joshua A Wood Philip H Kass Christopher J Murphy Paul Russell

PURPOSE To determine the impact of substratum stiffness and latrunculin-B (Lat-B), on the expression of several matrix proteins that are associated with glaucoma. METHODS Human trabecular meshwork (HTM) cells were cultured on hydrogels possessing stiffness values mimicking those found in normal (5 kPa) and glaucomatous meshworks (75 kPa), or tissue culture polystyrene (TCP; >1 GPa). Cells wer...

Journal: :IOP Conference Series: Materials Science and Engineering 2020

2016
Mohammad A. Sayem Yusuke Tomita Akira Yuno Masatoshi Hirayama Atsushi Irie Hirotake Tsukamoto Satoru Senju Eiji Yuba Toshiaki Yoshikawa Kenji Kono Tetsuya Nakatsura Yasuharu Nishimura

In a recent phase I clinical trial, a vaccine consisting of glypican-3 (GPC3)-derived CTL epitopes was found to be safe and induced measurable immune and clinical responses in patients with hepatocellular carcinoma (HCC). The aim of this study was to identify GPC3-derived long peptides (GPC3-LPs) carrying promiscuous HLA class II-restricted T helper (Th) cell epitopes. Using a computer algorith...

2014
N.N. Dang S.G. Pang H.Y. Song L.G. An X.L. Ma

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR...

2014
Alison R. Forrester Martina S. Elias Emma L. Woodward Mark Graham Faith M. Williams Nick J. Reynolds

BACKGROUND 2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD) is a potent activator of the aryl hydrocarbon receptor (AhR) and causes chloracne in humans. The pathogenesis and role of AhR in chloracne remains incompletely understood. OBJECTIVE To elucidate the mechanisms contributing to the development of the chloracne-like phenotype in a human epidermal equivalent model and identify potential biomar...

Journal: :Biochimica et biophysica acta 2008
Ryoji Hamanaka Tetsuji Shinohara Shinji Yano Miki Nakamura Aiko Yasuda Shigeo Yokoyama Jian-Qiang Fan Kunito Kawasaki Makoto Watanabe Satoshi Ishii

Active-site-specific chaperone therapy for Fabry disease is a genotype-specific therapy using a competitive inhibitor, 1-deoxygalactonojirimycin (DGJ). To elucidate the mechanism of enhancing alpha-galactosidase A (alpha-Gal A) activity by DGJ-treatment, we studied the degradation of a mutant protein and the effect of DGJ in the endoplasmic reticulum (ER). We first established an in vitro trans...

Journal: :Actas dermo-sifiliograficas 2015
J Hernández-Godoy C Casado-Sánchez L Landín A A Rosell

In conclusion, BSI is a rare genodermatosis belonging to the group of ARCI. It has a series of clinical and diagnostic peculiarities that we should be aware of. Although the diagnosis is usually clinical, confirmation can only be made by genetic analysis of the TGM-1 gene. This is the only gene implicated in this condition, but its mutations are also the most prevalent in other forms of ARCI, a...

نمودار تعداد نتایج جستجو در هر سال

با کلیک روی نمودار نتایج را به سال انتشار فیلتر کنید