نتایج جستجو برای: trinucleotide

تعداد نتایج: 1983  

Journal: :Chemical communications 2016
Yoojin Park Ki Tae Kim Byeang Hyean Kim

We have developed a simple and sensitive system for detecting AGG trinucleotide repeats through the formation of intermolecular G-quadruplexes using a fluorescent oligonucleotide. The fluorescence signal increased rapidly and dramatically by 44.7-fold with respect to the low background signal in the presence of RNA agg repeats and by 35.0-fold in the presence of DNA AGG repeats.

2012
Mark A. Pook

DNA methylation of CpG dinucleotides is essential for mammalian development, X inactivation, genomic imprinting, and may also be involved in immobilization of transposons and the control of tissue-specific gene expression (Bird & Wolffe, 1999). The common theme in each of these processes is gene silencing. Therefore, gene silencing is a major biological consequence of DNA methylation. As such, ...

2016
Wadim Kapulkin

associated trinucleotide repeat (NGG)n in Caenorhabditis elegans. Abstract: This work describes the experience with implementation of Streptococcus pyogenes Cas9 nuclease, expressed in C. elegans germline. The described work utilizes guide RNA-unc-22-1000 (GGAGAAGGAGGCGGTGCTGG) designed to target the polyglycine encoding stretch within the unc-22gene embedding the impure trinucleotide (NGG)n PA...

2014
Jiaxin Hu Jing Liu K. Jayaprakash Narayanannair Jeremy G. Lackey Satya Kuchimanchi Kallanthottathil G. Rajeev Muthiah Manoharan Eric E. Swayze Walt F. Lima Thazha P. Prakash Qin Xiang Carlos Martinez David R. Corey

Dentatorubral-pallidoluysian atrophy (DRPLA) is a progressive neurodegenerative disorder that currently has no curative treatments. DRPLA is caused by an expansion of a CAG trinucleotide repeat region within the protein-encoding sequence of the atrophin-1 (ATN-1) gene. Inhibition of mutant ATN-1 protein expression is one strategy for treating DRPLA, and allele-selective gene silencing agents th...

Journal: :South African medical journal = Suid-Afrikaanse tydskrif vir geneeskunde 2008
D S Magazi A Krause V Bonev M Moagi Z Iqbal M Dludla C H van der Meyden

OBJECTIVE Huntington's disease (HD) has been reported to occur rarely in black patients. A new genetic variant- Huntington's disease-like 2 (HDL2)--occurring more frequently in blacks, has recently been described. The absence of an expanded trinucleotide repeat at the chromosome 4 HD locus was previously regarded as a way of excluding classic HD. The objective of this paper is to describe a num...

2010
Judy F.C. Chow William S.B. Yeung Estella Y.L. Lau Stephen TS Lam Tony Tong Pak-Chung Ho

Objective: To report a successful case of preimplantation genetic diagnosis (PGD) for Huntington’s disease using whole genome amplification Design: Case report Setting: University assisted reproduction unit Patient(s): A couple with family history of Huntington’s disease; the husband was carrying the expanded allele of the IT15 gene, while the wife had the normal allele. Intervention(s): PGD wi...

Journal: :Fertility and sterility 2009
Judy F C Chow William S B Yeung Estella Y L Lau Stephen T S Lam Tony Tong Ernest H Y Ng Pak-Chung Ho

OBJECTIVE To report a successful case of preimplantation genetic diagnosis (PGD) for Huntington disease using whole genome amplification. DESIGN Case report. SETTING University assisted reproduction unit. PATIENT(S) A couple with family history of Huntington disease: The husband was carrying the expanded allele of the IT15 gene, and the wife had the normal allele. INTERVENTION(S) Preimp...

نمودار تعداد نتایج جستجو در هر سال

با کلیک روی نمودار نتایج را به سال انتشار فیلتر کنید