Although the p53 anti-oncogene is an important target for gene therapy of cancer, some cancers are resistant to p53 gene transfer. For this reason, it is important to find effective drugs to enhance cytotoxic effects of p53 gene transfer. Recent reports demonstrated that some histone deacetylase inhibitors in combination with p53 gene therapy induced apoptosis in certain cancer cells more effic...

The p53 nuclear phosphoprotein plays a critical role in transcriptional regulation of target genes involved in growth arrest and apoptosis. The natural polyamines, including spermidine, spermine, and their precursor putrescine, are required for cell proliferation, and decreasing cellular polyamines inhibits growth of the small intestinal mucosa. In the current study, we investigated the mechani...

Inactivation of the p53 tumor suppressor gene is a common finding in human cancer. In most cases, inactivation is due to a point mutation in the gene, but rearrangement of the p53 gene is sometimes observed. We analyzed the inactivation of p53 in the human pancreas cancer cell line Hs766T, which harbors a structural alteration in the p53 gene. This inactivation was found to be the result of a c...

The p53 gene is currently considered to function as a tumor-suppressor gene in various human malignancies. In hematologic malignancies, alterations in the p53 gene have been shown in some human leukemias and lymphomas. Although mutations in the p53 gene are infrequent in acute myelogenous leukemia (AML) patients, we show in this report that alterations in the p53 gene are frequent in myeloid le...

Background:Non-Melanoma Skin Cancer (NMSC), the most prevalent types being Squamous Cell Carcinoma (SCC) and Basal Cell Carcinoma (BCC), is the most common type of malignancy in human beings. These neoplasms are more frequent in the elderly and fair skinned people and mainly occur on sun-exposed sites of the body. Ultraviolet B (UVB) has a wel...

PURPOSE A previous report of ours noted that not only p53 protein overexpression, but also p53 gene mutation. were indeed detected in pterygium. BaP 7,8-diol 9,10-epoxide (BPDE), an ultimate metabolite of BaP, attacks deoxyguanosine to form a BPDE-N2-dG adduct resulting in p53 mutations. The relationship between BPDE-like DNA adduct levels and abnormal p53 has not been clear in pterygium. There...

The p53 mutants 248Trp, 175His, and 281Gly fail to activate transcription mediated by p53CON element (GGACATGCCCGGGCATGTCC) or the ribosomal gene cluster element (ACGTTTGCCTTGCCTGGACTTGCCTGGCCTTGCCTT). We studied the effect of these inactive p53 mutants on the transcriptional activity of wild-type p53 by cotransfection of both wild-type and mutant p53 expression vectors into p53-null K562 chron...