This research aims to develop a framework of consumer–brand relationship by taking an experiential view. In this article, the authors report a cross-cultural comparative study that was conducted on a sample of real consumers at coffee chain stores in Shanghai, China, and Taipei, Taiwan. The findings reveal that individual as well as shared experiences work through brand association, brand perso...

Citation: Fournier S and Muller O (2015) Commentary " Recent advances in circadian rhythms in cardiovascular system ". Front. Pharmacol. 6:132. We read the recent publication by Chen and Yang with interest (Chen and Yang, 2015). In this review of excellent quality, the authors detail our current understanding of the links between circadian rhythms and cardiovascular system. Nevertheless, severa...

The question of the mercurial treatment of tabes has been very often debated in congresses and also learned societies in France during recent years. Diametrically opposite opinions have been expressed with equal firmness. On the side of the syphilographers, Fournier, Gaucher and Hallopeau trace a very fine dividing-line between syphilitic spinal complications which may be treated

SEQUENCE AND ITS ORIGIN: 240 bp of pBma5, a -2.8 kb //mdlll-fiamHI fragment subcloned in pBR327. The fragment is derived from the 10.4 kb insert of the lambda recombinant I^Ad isolated from a Bombyx mori genomic library (Fig. 1 of Fournier et al., 1984). . 60 AAGCTTTGTAGTATAATTTCGTCAGTTCATAATCCTCCTGGTATGTATGAAGATTTTCTT . 120 TTGAAAACCTATCAGCTATTTTTAACGGTAGTGGATAGCCCGGCTAGCTCAGTCGGTAGA . 180 GCA...

G La Ruche ([email protected])1, A Goubard2, B Berçot3, E Cambau3, C Semaille1, P Sednaoui2 1. French Institute for Public Heath Surveillance, Department of infectious diseases, Saint-Maurice, France 2. Institut Alfred Fournier, National Reference Laboratory for gonorrhoea, Paris, France 3. Laboratory of Bacteriology, Virology and Hygiene, Saint-Louis/Lariboisière/Fernand Widal hospitals,...