The p53 mutants 248Trp, 175His, and 281Gly fail to activate transcription mediated by p53CON element (GGACATGCCCGGGCATGTCC) or the ribosomal gene cluster element (ACGTTTGCCTTGCCTGGACTTGCCTGGCCTTGCCTT). We studied the effect of these inactive p53 mutants on the transcriptional activity of wild-type p53 by cotransfection of both wild-type and mutant p53 expression vectors into p53-null K562 chron...

Although epigenetic maintenance of either the active or repressed transcriptional state often involves overlapping regulatory elements, the underlying basis of this is not known. Epigenetic and pairing-sensitive silencing are related properties of Polycomb-group proteins, whereas their activities are generally opposed by the trithorax group. Both groups modify chromatin structure, but how their...

ATF-2 is a cellular basic region-leucine zipper (bZIP) transcription factor that can mediate diverse transcriptional responses, including activation by the adenovirus Ela protein. ATF-2 contains an activation domain, required for transcriptional activity, but in the absence of an appropriate inducer, full-length ATF-2 is transcriptionally inactive. Here we have investigated the mechanism underl...

In Saccharomyces cerevisiae, the transcription factor Yap8 is a key determinant in arsenic stress response. Contrary to Yap1, another basic region-leucine zipper (bZIP) yeast regulator, Yap8 has a very restricted DNA-binding specificity and only orchestrates the expression of ACR2 and ACR3 genes. In the DNA-binding basic region, Yap8 has three distinct amino acids residues, Leu26, Ser29 and Asn...

We have previously shown that the delta E3 site is an essential element for transcriptional activation by the human T-cell receptor (TCR) delta enhancer and identified two factors, NF-delta E3A and NF-delta E3C, that bound to overlapping core (TGTGGTTT) and E-box motifs within delta E3. In this study, we show that protein binding to the core motif is necessary but not sufficient for transcripti...

Modern computational methods are revealing putative transcription-factor (TF) binding sites at an extraordinary rate. However, the major challenge in studying transcriptional networks is to map these regulatory element predictions to the protein transcription factors that bind them. We have developed a microarray-based profiling of phage-display selection (MaPS) strategy that allows rapid and g...

Mammalian cells express two distinct forms of transcription factor CREB (cAMP response element binding protein) that are apparently the products of alternative splicing of the CREB gene transcript. The two proteins differ by a 14-amino acid serine-rich insertion present in one of the CREB isoforms. We show that both CREB isoforms are expressed in many cell types and mammalian species. Both enco...

We present evidence that CRE-BP1 binding to the cyclic AMP (cAMP) response element (CRE) is a transcriptional activator. Transcriptional activation was assayed by cotransfection into CV-1 cells of a CRE-BP1 expression plasmid together with a reporter plasmid in which the thymidine kinase promoter and four tandem repeats of CRE were linked to the chloramphenicol acetyltransferase (CAT) gene. Cot...

By in vivo DMS footprint and reporter gene analyses we identified two transcription factor binding sites in the human c-sis/PDGF B gene promoter. The low basal activity of the PDGF B promoter in HeLa and undifferentiated K562 cells, which express low PDGF B mRNA levels, and in PC3 cells, which express a high PDGF B mRNA level, results from binding of a weak transcriptional activator between pos...

It has been demonstrated that the hepatocyte nuclear factor 1 (HNF1) binding site is critical for the majority of the hepatitis B virus (HBV) large surface antigen promoter activity in differentiated hepatoma cell lines. Examination of a series of clustered point mutations in the minimal large surface antigen promoter demonstrated that the HNF1 and TATA box binding sites are the major regulator...