Structures of p63 DNA binding domain in complexes with half-site and with spacer-containing full response elements.
نویسندگان
چکیده
Transcription factor p63, a p53 family member, plays a role in epithelial cell development, cell cycle arrest, apoptosis, and tumorigenesis. Point mutations, primarily in the DNA binding domain (p63DBD), lead to malformation syndromes. To gain insight into differences between p63 and p53 and the impact of mutations on the structure, we have determined two crystal structures of p63DBD in complex with A/T-rich response elements. One complex contains a 10-bp DNA half-site response element (5'AAACATGTTT3') and the other contains a 22-bp DNA full response element with a 2-bp spacer between two half-sites (5'AAACATGTTTTAAAACATGTTT3'). In both structures, each half-site binds a p63DBD dimer. The two p63DBD dimers do not interact in the presence of the DNA spacer, whereas they interact with one another in the p63DBD/10-bp complex where the DNA simulates a full response element by packing end-to-end. A unique dimer-dimer interaction involves a variable loop region, which differs in length and sequence from the counterpart loop of p53DBD. The DNA trajectories in both structures assume superhelical conformations. Surface plasmon resonance studies of p63DBD/DNA binding yielded K(d) = 11.7 μM for a continuous full response element, whereas binding was undetectable with the 22-bp DNA, suggesting an important contribution of a p63DBD interdimer interface to binding and establishing that p63DBD affinity to the response element is approximately 1,000-fold lower than that of p53DBD. Analyses of the structural consequences of p63DBD mutations that cause developmental defects show that, although some mutations affect DNA binding directly, the majority affects protein stability.
منابع مشابه
Structure of p73 DNA-binding domain tetramer modulates p73 transactivation.
The transcription factor p73 triggers developmental pathways and overlaps stress-induced p53 transcriptional pathways. How p53-family response elements determine and regulate transcriptional specificity remains an unsolved problem. In this work, we have determined the first crystal structures of p73 DNA-binding domain tetramer bound to response elements with spacers of different length. The str...
متن کاملTransactivation by the thyroid hormone receptor is dependent on the spacer sequence in hormone response elements containing directly repeated half-sites.
The thyroid hormone receptor (TR) regulates the transcription of its target genes by interacting with specific hormone response elements consisting usually of directly repeated half-sites with the consensus sequence AGGTCA. To investigate the role of the spacer sequences separating the half-sites, heterodimers formed by TRalpha and the retinoid-X receptor (RXR) were used in a PCR based selectio...
متن کاملInvestigation and Determination the Binding Site of Glycyrrhizin of Liquorice to DNA
Glycyrrhizin(GL), is a triterpenoid saponin found in glychyrrhiza glabra (liquorice). This compound is a frequently used and very effective drug for the treatment of various malignancies. This study was designed to examine the interactions of glycyrrhizin with calf thymus DNA in aqueous solution at physiological conditions. FTIR spectroscopic method was used to determine the ligand binding mode...
متن کاملNoncanonical DNA Motifs as Transactivation Targets by Wild Type and Mutant p53
Sequence-specific binding by the human p53 master regulator is critical to its tumor suppressor activity in response to environmental stresses. p53 binds as a tetramer to two decameric half-sites separated by 0-13 nucleotides (nt), originally defined by the consensus RRRCWWGYYY (n = 0-13) RRRCWWGYYY. To better understand the role of sequence, organization, and level of p53 on transactivation at...
متن کاملDiverse p53/DNA binding modes expand the repertoire of p53 response elements.
The tumor suppressor protein p53 acts as a transcription factor, binding sequence-specifically to defined DNA sites, thereby activating the expression of genes leading to diverse cellular outcomes. Canonical p53 response elements (REs) are made of two decameric half-sites separated by a variable number of base pairs (spacers). Fifty percent of all validated p53 REs contain spacers between 1 and...
متن کاملذخیره در منابع من
با ذخیره ی این منبع در منابع من، دسترسی به آن را برای استفاده های بعدی آسان تر کنید
عنوان ژورنال:
- Proceedings of the National Academy of Sciences of the United States of America
دوره 108 16 شماره
صفحات -
تاریخ انتشار 2011